Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST50240
Clone ID OST50240
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST50240
Sequence
ACTGAGACTGTCTGGCTTCCCCACTATGCCCATGCTTTGCTAAGTGCTGGTGGCCATCGAAGTTTTTGCATCCTGGGGAC
GAATCCTGAGCTGACCAGAGACGGACGGCGCANGACAAGTGGTGTTCAGAGAATTTACTGCAAGCAAGATATCATGGCTG
TTCTCGGAGGACTGGGCAGTCACTAACAAATCCATTTTTCTTATCGGGATCTGTATAGTTCAGNGATCTTTCTGCTCTCT
GCTCCAAGCTAAGAACAGAGAGCTTTGCCTCCCAGCCTGAAATTATGTGTCAGCTGGTACACAGCTATGTGTGTTCTTTC
CATCCCCAGGGCCCAGGGCACTGGTGTTGGTTAAAGGGGCTCTCTTTGAAGGTCCCCAGAGATTCCAAGAGATGCACCTC
AGTG
Sequence Type mRNA
Unitrap ID UNI27756

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 5264981..5298252 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020627 (Klhl29) kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

 
Come back to gene ENSMUSG00000020627


For any suggestions or comments, please send an email to unitrap@crg.es