Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST50125
Clone ID OST50125
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST50125
Sequence
GTGATGAATGGTGCTATCCTGCAGCAAGTGTTTGTGGTGGATTATGTTGTTCAGTCCCAAATGTGTGGAGACTGCCATAG
AGTGGAAGCTAAGGATTTCTGGAAGGCTGTGATCCAAGTCAGGCAAAAGACTCTACACAAGAAAACATTCTACTATCTGG
AACAGTTGATTTTAAAATATGGAATGCATCAGAATACACTGCGTATCAAGGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27758

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 69534327..69535569 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027787 (Nmd3) NM_133787 NMD3 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Nmd3-001]

 
Come back to gene ENSMUSG00000027787


For any suggestions or comments, please send an email to unitrap@crg.es