Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST50083
Clone ID OST50083
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST50083
Sequence
GAACACTGAGGTCTTGAAGAAAGTCTCCAAATACATTCAAGAACAGAATGANAANATATATGCTCCCCAAGGCCTCCTCC
TNACAGACCCCATTGAGAGAGGACTTCGAGTTATTGAAATCACCATCTATNAAGACAGAGGTGTGAGCAGTGGAAGATAA
ACCACAGAGTTACAGGTCCTGCCTCCAGCTGGGACCTTCGTCTATCCACTGGCCGATGGCAGAGTGTCCCTACCTCCTCT
CCAGAGCGTNATTCTCTTGTCTCTGCTGCCAGAGCCACGGNGCCACACCTGGAGTGACCGNTCGNCACTCANCATCCACT
TTGTNTCCCAGTTGNGTAGGACTCTGNGATCTTTTGATTGGTTCCAAGAAAATAAAGGGAAGC
Sequence Type mRNA
Unitrap ID UNI27763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 24352896..24356438 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015341 (Golga7) NM_001042484 golgi autoantigen, golgin subfamily a, 7 Gene [Source:MGI (curated);Acc:Golga7-001]

 
Come back to gene ENSMUSG00000015341


For any suggestions or comments, please send an email to unitrap@crg.es