Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST612
Clone ID RST612
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST612
Sequence
CATTCACCAACCTTTCAAGCTTGGTAGTGCTGCATCTTCATAACAATAAAATTAAAAGCCTCAGTCAACACTGTTTTGAT
GGACTAGATAACCTGGAAACCCTGGACTTGAATTATAATAACTTGGATGAATTTCCTCAGGCTATTAAAGCCCTTCCCAG
CCTTAAAGAGCTGGGATTTCACAGTAATTCTATTTCTGTTATCCCGGATGGAGCATTTGCTGGTAATCCACTGCTAAGAA
CTATCCATTTGTATGATAATCCTCTGTCTTTTGTGGGGAACTCAGCATTTCACAACCTGTCTGATCTGCATTCCTTAGTC
ATTCGTGGTGCAAGCCTGGTGCAGTGGTTCCCCAATCTGGCCGGAACTGTCCATCTGGAGAGTCT
Sequence Type mRNA
Unitrap ID UNI8920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109836896..109841155 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]

 
Come back to gene ENSMUSG00000050199


For any suggestions or comments, please send an email to unitrap@crg.es