Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST639
Clone ID RST639
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST639
Sequence
GTGGTCAGTCAGGATGCGGCTCTCGAGCAGCCTGTCATTACGATTATGGCTGTCGATGCTGATGGCCCCTCAAACAGCCA
CATCCACTACTCCATTATAGAGGGGAACCAGGGAAGTCCGTTCACAATTGACCCTGTCAGAGGAGAAGTGAAAGTGACGA
AGCCCCTAGACCGGGAAAC
Sequence Type mRNA
Unitrap ID UNI8927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 46118866..46119322 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070047 (Fat1) NP_001074755 FAT tumor suppressor homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109168]

 
Come back to gene ENSMUSG00000070047


For any suggestions or comments, please send an email to unitrap@crg.es