Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST49424
Clone ID OST49424
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST49424
Sequence
TGCTTCTGGATGAGAGACTGATGCCCAAGCTGGGAGACTTTGGCCTGGCTCGTTTCAGCCGCTTTGCGGGGGCCAAA
Sequence Type mRNA
Unitrap ID UNI27781

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71265790..71265866 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031392 (Irak1) NM_008363 interleukin-1 receptor-associated kinase 1 Gene [Source:MGI (curated);Acc:Irak1-004]

 
Come back to gene ENSMUSG00000031392


For any suggestions or comments, please send an email to unitrap@crg.es