Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST656
Clone ID RST656
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST656
Sequence
GAACTGGATTTGTCCTATAACCAGCTGACCCGCCTTGATGAATCTGCCTTTGTGGGTCTGAGCTGACTGGAGAGATTGAA
TTTAGGGGACAATAGAGTCACTCACATTGCTGATGGTGTATTTAGGTTTCTTTCCAATCTTCAGACATTAGATTTGAGAA
ACAATGACATTTCATGGGCCATAGAAGATGCTAGCGAAGCCTTTTCTGGACTCAAAAGTCTCACTAAGTTAATCTTGCAA
GGAAACCGGATTAAGTCAGTTACACAGAAAGCATTCATTGGCCTTGAGTCCCTTGAGTATCTAGATTTGAACAACAATGC
TATAATGTCTATCCAAGAAAATGCTTTTTCTCAGACTCACTTAAAGGGACT
Sequence Type mRNA
Unitrap ID UNI8933

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104283705..104294596 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es