Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST48984
Clone ID OST48984
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST48984
Sequence
AGACTGAGGTGGGTTTGGGCTGGAGGCNAGCCTGNNCCCCGGNNACTCTNTCTTCANGGANNCACNACTNATNNGATGAA
CCGAANAGGAGTGGNGGAGACTTGGTGTCCAACAGAGTCTAGGATGGGTTCATTACATGATTCATGAGCCAGAACCGCAT
ATTCTTCTCTTTAGACGACCTCTTCCAAAAGAACAACAAAAATGAAGTGCAGCTGGGATCATCTAATCTTTTTCAAATTT
AATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTGAAAAGTGTACAAACCTTTCATCCATACCTGTGCATGCGC
TGTATTCTTCACAGCAACAGAGCTCAGTCAAATGCAACTGCAAGTAGGGTTGTTTTAAGTTGTTCAAGATAGTTTCTTGN
AGTTTTTTCTTAATATAAATGCCTGNTTTATTTTACCTGGTTTGGTTAAAAAAAAGTTGGGTTATGGCATTTA
Sequence Type mRNA
Unitrap ID UNI14455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51744975..51746024 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062248 (Cks2) NM_025415 CDC28 protein kinase regulatory subunit 2 Gene [Source:MGI (curated);Acc:Cks2-001]

 
Come back to gene ENSMUSG00000062248


For any suggestions or comments, please send an email to unitrap@crg.es