Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST48953
Clone ID OST48953
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST48953
Sequence
CTATTCCCTGGTGGACTCCAGTCAAGTGTCGACATTTCTGATATCCATTCTTCTTATAGTCTATGGTAGTTTCAGGTCTC
TTAATATGGACTTTGAAAACCAAGATAAGGAGAAAGACAGCAACAGTTCTTCTGGCTCTTTCAATGGCAACAGCACCAAT
AACAGCATCCAGACCATTGATTCCACCCAAGCACTGGTCCTCCCGANTGGAGCCGTCTGTCTCTCTCCTCGTCATGTTCT
TCTTNTTTGATTCAGTTCAAGG
Sequence Type mRNA
Unitrap ID UNI16396

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115511574..115532325 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es