Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XI446
Clone ID XI446
Vector pGT1cd72
Project baygenomics

Sequence tag XI446
Sequence
GGGCATTCTGGACCGTAACCCTCGCTTGCAATGGCTGCGTCTTTGGTCGGGAAGAAGATCGTGTTTGTGACGGGAAACGC
CAAGAAGCTGGAGG
Sequence Type mRNA
Unitrap ID UNI5965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130493576..130493669 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074797 (Itpa) NM_025922 inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene [Source:MGI (curated);Acc:Itpa-001]

 
Come back to gene ENSMUSG00000074797


For any suggestions or comments, please send an email to unitrap@crg.es