Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST48532
Clone ID OST48532
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST48532
Sequence
CGCTGCTATTCTCATGGGTCACACGAGACAGATGAGGAGTTTGATGCTCGCTGGGTGACATATTTCAACAAGCCAGACAT
TGATGCCTGGGAATTGCGTAAAGGGATGAATACACTTGTTGGCTATGATCTGGTTCCTGAGCCCAAAATCATTGATGCTG
CATTGCGAGCATGTAGACGGNTAAATGATTTTGCTAGTGCTGNTCGCATCTTGGAGGTTGTTAAGGACAAAGCAGGACCT
CATAAGGAAATCTATCCCTATGTCATCCAGGAACTTAGACCAACTTTAAATGAATTGGGAATCTCCACTCCAGAGGAGCT
GGGCCTTGACAAAGTGTAAACTCCCTTCGATGGGCTTCCTAAGGACTTAACTGCTATTGCTACTTGATTGNAACAGTTGN
CTGGAAATGTTTTATTTGAACAAATTTT
Sequence Type mRNA
Unitrap ID UNI12427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57376777..57380167 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000088 (Cox5a) NM_007747 cytochrome c oxidase, subunit Va Gene [Source:MGI Symbol;Acc:MGI:88474]

 
Come back to gene ENSMUSG00000000088


For any suggestions or comments, please send an email to unitrap@crg.es