Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST48367
Clone ID OST48367
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST48367
Sequence
ACCTGAAGCAGAAGCTGGAGAGCAACACNANATTCTGCCANGCTAGGANGCTATGAAGCGAATTGNTGNGATGATTGCTG
AAGGGGAAAAATGCCTCGGAACTCTTCCCTGCTGTTGTGAAGAATGTGGCCAGTAAAAACATCGAGATCAAGAAAAAAAA
A
Sequence Type mRNA
Unitrap ID UNI8390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95160755..95164748 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021686 (Ap3b1) NM_009680 adaptor-related protein complex 3, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1333879]

 
Come back to gene ENSMUSG00000021686


For any suggestions or comments, please send an email to unitrap@crg.es