Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST48266
Clone ID OST48266
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST48266
Sequence
AGGAGGGCCCCAGGCTCTCCAAGAACCAAGAAGTTCTCCGAGCACTTCAGCATCCACTGCTGCCCACCCTTCACCTTCCT
CAACTCCAAGCGTGAGATCGTGGACCGCAAGTACAGCATCTGCAAGAGCGGTTGCTTTTACCAGAAGAAGGAGGAGGACT
GGATCTGCTGTGCCTGCCAGAAGACTAGCCGCCGTGCCACGTCCCCTCAGAGGCCCAAGCACCAGCCAGCTGCGTCCCCA
GTGGTGGTCAGAGCGCCGCCAGCCAAGCCAAAGTCCCCTCTGATGCCAGCCAAGCCAAGGTCCCCACCGAGGCCAGCCAA
GCCAAGGTCCCCTTCAAGGACTGAGCGCCAGCCGCGTNCCCCGCCCAGAGGTCCGACCACC
Sequence Type mRNA
Unitrap ID UNI16301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120076942..120077532 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032517 (Mobp) NM_008614 myelin-associated oligodendrocytic basic protein Gene [Source:MGI Symbol;Acc:MGI:108511]

 
Come back to gene ENSMUSG00000032517


For any suggestions or comments, please send an email to unitrap@crg.es