Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE241
Clone ID RRE241
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE241
Sequence
GCTTGGACAACCACTCCTTGGACTCTACCCAGTAACCTTGCACTATGCGTCAATCCAGAAATACAGTATGTGAAGATCAA
AGATGTGGCCAGGGGAAAATTATTCATCTTAACGGAAGCCAGATTATCGGCCCTCTATAAGCAAGAGAGCGACTATGAGA
TACTTGAAAGGTTTCCTGGTGCCTCTCTCAAAGGCAAGAAATACAAGCCGTTGTTTGACTACTTTATTAAGTGTAAGGAG
AACGGTGCCTTCACCGTGCTTGTCGACCACTATGTGAAGGATGAAGAAGGCACAGGCGTTGTGCACCAGGCTCCTTACTT
TGGTGCTGATGATCATCGTGTCTGTATGGACTTCAACATTATTCAGAAAGACTCAGTCCCTGTTTGTCCTGTGGATGCTT
CAGGCTGCTTCACAGAGGAAGTGACACATTTTGTGGGGCAGTATGTGAAGGATGCTGACAAAAATATCATTAGGATGTTG
AAGGAGCAGGGCCGGCTGCTGGCGGCGGGCACGTTCACTCACAGCTACCCTTTCTGCTGG
Sequence Type mRNA
Unitrap ID UNI8955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49788459..49800291 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es