Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47658
Clone ID OST47658
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47658
Sequence
TGGTCAAACAGTGGGATGTATTTAGCTTCTGGGGGAGATGACAAACTGATTATGGTGTGGAAGCGGGCTACGTACATTGG
GCCCAGCACTGTGTTTGGTTCCAGTGGTAAGCTTGCCAATGTGGAGCAATGGCGGTGTGTCTCCATCCTCCGGAGTCACT
CAGGCGATGTGATGGATGTAGCATGGTCTCCCCACGACGCCTGGCTGGCCTCATGCAGCGTGGATAACACTGT
Sequence Type mRNA
Unitrap ID UNI27803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18897811..18910807 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022702 (Hira) NM_010435 histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Hira-001]

 
Come back to gene ENSMUSG00000022702


For any suggestions or comments, please send an email to unitrap@crg.es