Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47641
Clone ID OST47641
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47641
Sequence
AGGCCTCATGTCTCCAAGCCGCCTGCCTGGCAGTCGAGAACGTGACTGGGAGAATGGAAGCAATGCATCCTCCCCAGCAT
CAGTGCCTGAGTACACAGGTCCCCGGCTATACAAGGAACCCAGCGCCAAGTCTAACAAGTTTATCATCCACAATGCCTTG
TCACACTGCTGCCTGGCAGGCAAGGTGAATGAGCCCCAGAAGAACAGAATTCTAGAGGAAATCGAGAAAAGCAAGGCCAA
CCACTTCCTGATTCTCTTTCGGGACTCAAGCTGCCAGTTCCGGGCCCTCTACACTCTGTCTGGGGAGACAGAGGAGCTAT
CGAGGCTGGCAGGCTATGGGNCCTCGGACCGTGANTTCTGCCATGGTCNAAGGCATCTATAANAGCCTGAACTGGCTTTA
Sequence Type mRNA
Unitrap ID UNI27805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3608204..3608761 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044433 (2310057J16Rik) NM_027171 RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]

 
Come back to gene ENSMUSG00000044433


For any suggestions or comments, please send an email to unitrap@crg.es