Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47505
Clone ID OST47505
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47505
Sequence
ACTGAGGATATCTGCGACGATCCCCGGCTCTTCGTAGATGGCATCAGCTCCCATGACCTGCACCAGGGCCAGGTGGGCAA
CTGCTGGTTTGTGGCTGCCTGCTCATCACTGGCCTCCCGAGAGTCACTCTGGCAGAAGGTGAGGCCTGGGGACAGGAGGG
TGCGGGGGGNTAATCAAATAGCCCACGGCTCTCACTACCCAACGGGTGTGGCATCAGTGAGGAGTGTGGCTTCCTGAAAG
CCGGGTGTTGGCATGGGCAGAGCATCCTAGTTGGCAGGTTGGCCTCTCCTTACC
Sequence Type mRNA
Unitrap ID UNI27809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105300166..105300455 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035547 (Capn5) NM_007602 calpain 5 Gene [Source:MGI (curated);Acc:Capn5-001]

 
Come back to gene ENSMUSG00000035547


For any suggestions or comments, please send an email to unitrap@crg.es