Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47466
Clone ID OST47466
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47466
Sequence
GACTGAGATTTTACCAGATGTTGCAAGGACTCTGGGATCCTTATGGTATTAAAATGCCGGAAAGAGAATTCTGCACTGAA
AGACTGTCTAACTGCTTACTATAATGATCCAGCCTTCTATGAAGAATGCAAACTGGAGTATCTCAAGGAAAGGGAAGAAT
TCAGAAAAACTGGAGTTCCTACCAAGAAGAGGCTGCAGAAGCTTCCCACAAACATGNNNGNANAGCGCTCATCAGGAAGT
CCCGTCTTACGGAAGCCAGTTATCACTTAACCCAGAAATGATGGACTGAAACAATGTTTGCTCACCCTGATCGTGAGATG
CCAGGACTTGGAAGG
Sequence Type mRNA
Unitrap ID UNI7975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 117974249..117984332 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039163 (Cmc1) NM_026442 COX assembly mitochondrial protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915149]

 
Come back to gene ENSMUSG00000039163


For any suggestions or comments, please send an email to unitrap@crg.es