Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47398
Clone ID OST47398
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47398
Sequence
CTGAGTCCTATTTTGTGACGGACTATGATCCAACCATTGAAGACTCATACACAAAGCAATGTGTGATCGATGACCGAGCT
GCCCGGCTGGACATTTTGGATACAGCCGGACAAGAGGAGTTTGGAGCCATGAGAGAGCAATACATGAGGACAGGCGAGGG
CTTCCTGTTGGTCTTCTCAGTCACGGATAGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTCAGAGTAA
AGGACCGTGATGAGTTTCCCATGATTTTAATTGGCAATAAAGCTGACCTGGACCATCAGAGACAGGTAACACAGGAAGAA
GGGCAGCAGTTAGCAAGGCAGCTCAAGGTCACAT
Sequence Type mRNA
Unitrap ID UNI2855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 121193885..121203935 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055723 (Rras2) NM_025846 related RAS viral (r-ras) oncogene homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1914172]

 
Come back to gene ENSMUSG00000055723


For any suggestions or comments, please send an email to unitrap@crg.es