Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47095
Clone ID OST47095
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47095
Sequence
GGTTCCGTTGACACACTGAGAACTTCCTGGNGAAACTAGTGAGCCAAGCTGGGACAGGTTTCTCCTTCAACCACAAGAGA
AGCCGACTCCGAGAGAAGCTGAGCCTTCTGCACTATGATCCAATAG
Sequence Type mRNA
Unitrap ID UNI17932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31918749..31918860 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029142 (Mrpl33) NM_025796 mitochondrial ribosomal protein L33 Gene [Source:MGI (curated);Acc:Mrpl33-001]

 
Come back to gene ENSMUSG00000029142


For any suggestions or comments, please send an email to unitrap@crg.es