Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47089
Clone ID OST47089
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47089
Sequence
ACTGAGAAGATGGGCAGCGTCCTGAGTGGACATTTTATCCAAGGTTCATCAGCAACATCCACACCTACCACATTGGAAAG
CAGTGCTTCTTCAATGGGGTCTTCCGGGGCAACAGGAGGTCTGTGGCAGAGAGGACAGTGGACAACAGCCTCGGGAAGAA
GAAATACGATNTTGNTCCCAGAAATGGNATCCCCNAATTGACACCAGGGGATAATCCGTACATGTTCCCANAACAGAGTA
ANGAGTTCTTCAAAGCGGGAGCAACTTTGCCTCCGGTGAACTTNTCACTNGNGCCTTTCTGGGANAAGGAAAANGCCTNC
ATTTTGTTGAACNAGATNCAAGAAGTNGNNGAGCTTGCCNACTGGGAAGGTGCCANATGCCCTTCCTACATGGGTTCT
Sequence Type mRNA
Unitrap ID UNI14987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45586393..45594270 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es