Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST47003
Clone ID OST47003
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST47003
Sequence
CCTGAGGCTGGTGGATGACCGTTGTGTGGTGGAACCTGCAGCTGGGGACCTGGACAACCCCCCCAAGAAGTTCCGAGATT
GCCTCTTCAAAGTGTGCCCCATGAACCGNTACTCTGCACAGAAACAGTACTGGAAAGCCAAGCAGACTAAACAGGACAAA
NAGAAGATTGCTGATGTGGTATTGCTGCAGAAGCTGCAGCACGCAGCCCAGATGGAGCAGAAGCAAAATGACACAGAGAA
CAAGAAGGTGCACGGGGACGTGGTGAAGTACGGCAGCGTGATTCAGCCTCTATTCCTCATCCCCCGGTGGCGCCTATGTG
ACCCGGTCCTCGGCAGTGCGCCTGCGGAGCAGCGTGCCGGGCGTGCGGCTGCTTCAAGACTCGGTGGACTTCTCGCTGGC
CGACGCCATCAACACTTGAGTTTCAAGAACACCCCCACCAACGAGAAAGGTGGAACTG
Sequence Type mRNA
Unitrap ID UNI15218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27210041..27727753 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es