Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST46238
Clone ID OST46238
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST46238
Sequence
GACTGAGTACACAAACAAGTTCCAGAGAGAGGAAGCCATGGCTGCAGTGATACTGGAGAGCATCTTTCTGAAGCGCTCCC
AGCAGAAAAAGAAAACATCACCTTTAAACTTCAAGAAGCGCCTGTTTCTCTTGACTGTACACAAACTTTCATACTATGAA
TATGACTTTGAACGTGAGATGCCAGGACTTGGAGNGGGTTCAATACATGTTGAGAAGATCACCTGNGTNGAAACAGNAAT
TCCTGAAAAAAATCCCCCACCANAAAGACAGATTCCGAGGAGAGGTGAGGAGNCNAGNGAAATGGAACAGATTTCAATCA
TTGAAAGGTTCCCGTACCCATTCCAGGTTGTATATGATGAAGGACCTCTCTATGTTTTCTCCCCAACTGAAGAGCTGAGA
A
Sequence Type mRNA
Unitrap ID UNI16967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131100163..131108628 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031264 (Btk) NM_013482 Bruton agammaglobulinemia tyrosine kinase Gene [Source:MGI (curated);Acc:Btk-002]

 
Come back to gene ENSMUSG00000031264


For any suggestions or comments, please send an email to unitrap@crg.es