Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45862
Clone ID OST45862
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45862
Sequence
GTGACCTTGGGGAAGGTGTTGAAAGTCATTGTGGTCATGAGGAGCCTGTTCATCGATCGCACGATTGTGAAGGGGTATAA
TGAGAGCGTCTACACAGAGGATGGAAAGCTGGACATATGGTCCAAATCCAGCTACCAAGTGTTCCAGAAGGTGACAGACC
ATGCCACCACTGCCCTGCTTCACTATCAGTTACCCCAGATGCCAGACGTCGTGGTCAGGTCCTTCATGACCTGGCTGAGA
AGCTACATTAAGCTGTTCCAGGCCCCGTGNCATNNCTGNAGNAAGATTNTACAAGATGGCCTTCCCCCGACGTGGANAGA
CTTCCGAACCCTGGAAGCTTTCCATGACACCTGCCGACAGTGACAGTGACCCC
Sequence Type mRNA
Unitrap ID UNI18064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29355739..29380031 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]

 
Come back to gene ENSMUSG00000026799


For any suggestions or comments, please send an email to unitrap@crg.es