Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE282
Clone ID RRE282
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE282
Sequence
GGAAGTTCCGTTGGGGAAGATGGCGGCGGCCGCGAGCACCCTTCTCTTCTTGCCGCCGGGGACTTCAGACTGAGCCTTCC
CCGGAAGAGTCGGGGCCGCTGGTGCGCCGCTTCCCCGGAGCCCAGGCTAACTTGGTTCCCCTCTGAGTGGCGGGGAAAGG
CTCCCCGGCTCGTGGCGGACCCAAGACCTCCCCGCTGTCAGGATCAAGGCTCAGGGGGAACCCGAG
Sequence Type mRNA
Unitrap ID UNI5529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98054374..98054599 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es