Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45768
Clone ID OST45768
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45768
Sequence
GACTGAGAATGGACAGCAATTTGTGGCAGAAAGAGCTTTGGAATATTTATGTCAACTTTCAAAAGACCCAAAAGAAGTAC
TTGGAGGTTTAAAGTGTCTCATGCGGATTATTCTTCCACAAGCTTTTCATATGCCAGAATCTGAATATAAAAAGAAAGAA
A
Sequence Type mRNA
Unitrap ID UNI27853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98099097..98101545 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009670 (Tex11) NM_031384 testis expressed gene 11 Gene [Source:MGI (curated);Acc:Tex11-001]

 
Come back to gene ENSMUSG00000009670


For any suggestions or comments, please send an email to unitrap@crg.es