Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE311
Clone ID RRE311
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE311
Sequence
CAACGGCAAACCTGCCTGCCTGCAGCACTGACCGGACTGCTGTCCAGACCACCATGAGAGACTTCCAGACAGAACTCCGG
AAGATCCTCGTGTCTCTCATTGAGGTGGCACAGAAGCTGTTAGCACTGAATCCCGATGCAGTTGAATTGTTTAAGAAGGC
AAATGCTATGCTGGATGAAGATGAGGATGAGCGAGTGGATGAGACTGCCTTGCGGCAGCTCACAGAGATGGGCTTTCCTG
AGAGCAGAGCCTCAAAGGCCCTTCGGCTGAACCA
Sequence Type mRNA
Unitrap ID UNI8972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25864381..25866103 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036352 (Ubac1) NM_133835 ubiquitin associated domain containing 1 Gene [Source:MGI (curated);Acc:Ubac1-001]

 
Come back to gene ENSMUSG00000036352


For any suggestions or comments, please send an email to unitrap@crg.es