Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45544
Clone ID OST45544
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45544
Sequence
CTGAGTTCTATAGAAAATGTTCTCAAAACACTGGTGAAAAGCTGCCGACCATACTTTCCAGCAGATTCAACAGCAGAAAT
GTTAGAAGAATGGCGGCCTTTAATGTGTCCTTTTGATGTAACAATGCAAAGGCCATCAGTTATTTTGAAATATTTCTTCC
TACCTCCCTTCCTCCAGAACTGCATCATAAAGGTTTTAAACTTTGGTTTGATGAATTAATTGGCCTTTGGGTTTCAGTGC
AAAATCTCCCACAGTGGGAGGGGCAATTAGTAAATCTCTTTGCTCGATTGGCTACAGATAATATAGGATACATAGATTGG
GATCCATATGTACCGAAGATATTTACAAGAATTCTGAGAAGCCTGAACCTCCCAGTGGGAAGCAGTCAAGTTTTANTCCC
CAGAATTTTTAACAAAATGCTTATTGATATA
Sequence Type mRNA
Unitrap ID UNI27863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30702812..30707792 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040850 (Psme4) NM_134013 proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI (curated);Acc:Psme4-001]

 
Come back to gene ENSMUSG00000040850


For any suggestions or comments, please send an email to unitrap@crg.es