Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45497
Clone ID OST45497
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45497
Sequence
AACTGAGGCCTGTTCCTCCACCATCGGCTCTGCAGCCAGCAGACTCTGATTTNTTCCCTGCTTCCATATCCCTTCCCGGG
CTGGAGCCTCCTGGTGGACCCGACCTCCTGGACGATGGCTTTGCCTATGATCCTTCTGCCCCCACGCTCTTCACTATGTT
GGACCTGCTGCCCCCANCACCACCACTTGCCAGTGCTGNGGAGGGTAGCGGGGGTGCAGGGGCCACCGTTGTGGAGTCTT
CTGGCCCAAAGCCCCTGTCACTGGACTCTTTTGCAGCGCCGGGCCCCGGGGATGTTGGNACTGNTAGCCTTGTGGGCAGC
AACATGTTTCCCAACCAGTACCGAGAGGCAGCTTTCGGGGGTGGCCTCCTATCTCAGGGCCTGAAACCACGTAACCTCTG
A
Sequence Type mRNA
Unitrap ID UNI15951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20191895..20192292 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002983 (Relb) NM_009046 avian reticuloendotheliosis viral (v-rel) oncogene related B Gene [Source:MGI (curated);Acc:Relb-001]

 
Come back to gene ENSMUSG00000002983


For any suggestions or comments, please send an email to unitrap@crg.es