Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45436
Clone ID OST45436
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45436
Sequence
TCCCTGAGTCATGGAAGACAGAAGAGCTGAAAGGNCATGTGAACAAGCCTGCGCGTCACTGCAGAGGCAGGACTATGACA
TGGCCCTCCAGCACTGCACCGACGCCCTGCTCTCTCTTGGCCAGTACTCCATGGCAGACTTCACAGGGCCGTGCCCGGTG
GAGGTTGAGCGCATCAAAATTGAGAGTCTTCTTTACAGAATTGCCTCATTCTTGCAATTGAAAAACTACGGGCAAGCTGA
TGAAGATTGTAGGCATGGTATGTTTAAAAAAATGGGACCCTTTTCTGATTTGAAGATTTAAAAAAATTATTAAAG
Sequence Type mRNA
Unitrap ID UNI17082

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107436260..107439271 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020721 (Helz) NM_198298 helicase with zinc finger domain Gene [Source:MGI (curated);Acc:Helz-002]

 
Come back to gene ENSMUSG00000020721


For any suggestions or comments, please send an email to unitrap@crg.es