Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRE340
Clone ID RRE340
Vector pGT2Lxf
Project baygenomics

Sequence tag RRE340
Sequence
GGAGAGGGCTGGCGGGAGAGGGAAAGGCGGCTATTGACGCGGCAGCTGGAGAATGAAGAAGGAGCATGTTAGTCACTGTC
AGTTCTCCGCGTGGTACCCACTTTTCCGAAGCCTTACCATCAAGAGTGTCATCCTCCCGCTTCCTCAGAATGTGAAAGAC
TATCTACTTGATGATGGGACTCTGGTGGTCTCAGGAAGGGAAGATCCGCCAACATGCTCCCAGTCAGACAGTGGTAACGA
AGCAGAGGAAACACAGTGGTCCGATGATGAGAGCACAGCCACACTTAC
Sequence Type mRNA
Unitrap ID UNI8976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5754128..5766006 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039128 (Cdc123) NM_133837 cell division cycle 123 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Cdc123-001]

 
Come back to gene ENSMUSG00000039128


For any suggestions or comments, please send an email to unitrap@crg.es