Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45392
Clone ID OST45392
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45392
Sequence
TCGGCCAAGTAGCGCTNCGAGGGGGATCCGGACAAGCAGGCTGATCTGCTACGCCTTGTGGCGCAACAGCTTGGCNNCCA
NNTTAGCATGGTGAAGAAGGGCTGCGTGGCTAGATGACTTCAATATGCTACNACAGGCNGGAGTGTGTGGACACCGAGGA
GAACCCCCAGGTGTACTTATGCTGCTGCGAAGGCAACTTCTGCAACNAGCGCTTCACCCACTTGCCGGAGCCTGGGGGCC
CAGAAG
Sequence Type mRNA
Unitrap ID UNI27874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119336652..119337194 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061393 (Acvr2b) NM_007397 activin receptor IIB Gene [Source:MGI Symbol;Acc:MGI:87912]

 
Come back to gene ENSMUSG00000061393


For any suggestions or comments, please send an email to unitrap@crg.es