Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45299
Clone ID OST45299
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45299
Sequence
GACTGAGGTGGGGTCTTTCATGGTGAGCTGTGACAACTGGATGAACATCAACCTCCGGGAGGTGATCTGCACGTCGCGGG
ATGGTGACAAGTTCTGGAGGATGCCTGAGTGCTACATCCGTGGCAGCACCATCAAGTACCTGCGCATCCCTGATGAGATC
ATTGACATGGTGCGGGAGGAGGCCGCCAAGGGCCGAGGGCGAGGAGGACCGCAGCAGCAGAAGCAGCAGAAAGGCCGAGG
CATGGGCGGCGCTGGCCGAGGTGTGTTTGGTGGCCGGGGCCGGGGTGGCATCCCAGGTGCAGGCCGAGGCCAGCCCGAGA
AGAAGCCAGGGCGGNAGGCAGGCAAACAGTGATCACTCCCTGCCTGAGCCGAGCCCAGAACGGTGGGTGAGGCCTCAAGG
CACCTTTGTGTGAAGCCCCACTTGGCGTCTGGTCCAGTGAAGTCCCTCGCTGGCCT
Sequence Type mRNA
Unitrap ID UNI16146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73201717..73202453 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031848 (Lsm4) NM_015816 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm4-001]

 
Come back to gene ENSMUSG00000031848


For any suggestions or comments, please send an email to unitrap@crg.es