Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45276
Clone ID OST45276
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45276
Sequence
CTGAGTTTAAGCGGCTACAGGGCAAGAGGAACNCGAGGGAGAGAGGAAATCAACTTTGTGGAGATCAAAGGTGATGACCA
ACTCAGTGGGGCTCAGCAGTGGATGACCAAGTCACTGACAGAAGAGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI7577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87666073..87666198 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004895 (Prcc) NM_033573 papillary renal cell carcinoma (translocation-associated) Gene [Source:MGI Symbol;Acc:MGI:2137738]

 
Come back to gene ENSMUSG00000004895


For any suggestions or comments, please send an email to unitrap@crg.es