Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45231
Clone ID OST45231
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45231
Sequence
AAATAAAAGCCCAGAATGCCCCATTCCACAAACAAAGAGCTAATCCTTGGCATCATGGCGGGGACTGCTGGGATCAGCTT
GCTGGCCTTCTGGTACCACAAGGTCCTCAAGCCAAGGACGACCATGAACTTCCCTAAGCTTCTTTCTCTGGGTAAGAAAT
TTGGTTCACTAACTCTGCCAGAGGAAAGCCACAGTGCGCAAGGAGCATCGGTGGTCTTTCAAAGGAGGCAACTCCAGATC
CTGGAAAAGCTAAACGAGCTACTGACCAACATGGAAGAACTGAAGGAGGAAATCAGATTCCTTAAAGAGACAATTCCAAA
GCTGGAGGAATGTATACAAGATGAATTCGGAGGGAAGGTGACAGTTCATAAGATCAGTCCTCAGCACAGAGCGAGAAAAA
AGAAGGGGACAACCGTTCAACGCTCAGCAACAAGTAACAAGCTCAGAGGAGGCAGAAAGTGAAGGGGGGTAANTGGCCTC
AGTGTTTCCCATGGCGAACTGGGTATGNCTCACATTATTGCTCTTATATAGATAGATAGGCNCAGTCATTTGCTCTGCTT
TTTAAAAGAAAATGGAAAGGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 80020646..80021224 560
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036368 (AW061290) NM_201361 Regulator of microtubule dynamics protein 2 (RMD-2)(mRMD-2)(Protein FAM82A1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BSE0]

 
Come back to gene ENSMUSG00000036368


For any suggestions or comments, please send an email to unitrap@crg.es