Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45129
Clone ID OST45129
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45129
Sequence
GTGTTGCTTTAAAATCNAGACTGTAGAACTAAGAGGGAAGAAAATTAGATTACAGATCTGGGACACAGCAGGGCAGGAGC
TGATTTAACAGCATTACCTCAGCCTATTACAGAAGTGCCAAGGGGATCATACTCGTATATGACATCACCAAGAAGGAGAC
GTTCGATGACTTGCCAAAGTGGATGAAGATGATTGACAAGTATGCTTCAGAAGACGCCGAGCTCCTCCTGGTTGGAAATA
AGCTGGACTGTGAGACAGACAGAGAAATCTCAAGGCAGCAAGGAGAAAAGTTTGCACAGCAGATAACCGGGATGCGCTTC
TGCGAAGCCAGTGCCAANGACAATTTCAATGTGGACCNAGATCTTTCTTGAAACCTTGNTTGATGNATATTTCTNGAAAA
AGAATGCCTTCTTTGATGTTTTTGGAGAAAACCGAGTTNTCCCAATTAGCCATCCTTGAGGT
Sequence Type mRNA
Unitrap ID UNI27890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66846684..66855433 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023460 (Rab12) NP_077768 RAB12, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab12-001]

 
Come back to gene ENSMUSG00000023460


For any suggestions or comments, please send an email to unitrap@crg.es