Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45104
Clone ID OST45104
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45104
Sequence
GAGTGACTCCCATGGACTGTGGTGGCAGCAGTGGTAGTGGAACATGGAGCCCGCAGTGGGCCACCAAAGAAGGAAGAACT
GGTTGGGGGCAAGAAGAAGGGCAGGACATGGGGCCCCAGTTCCACTTTGCAGAGGGAGCGAGCTGGAGGAGAGGAGAGGC
TCANGGCCCTGGGGGAAGGAAGCAAGCAGTGGTCCTCGANCGCCCCCAACCTGGGCAAATCCCCTAAGCCCTGCCCCCTA
TAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28443883..28444195 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040390 (Map3k10) NM_001081292 mitogen-activated protein kinase kinase kinase 10 Gene [Source:MGI (curated);Acc:Map3k10-001]

 
Come back to gene ENSMUSG00000040390


For any suggestions or comments, please send an email to unitrap@crg.es