Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST45029
Clone ID OST45029
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST45029
Sequence
CTGAGGAAGCTCAGAACCTCATGGCCTTGACCAATGTGGACACTCCATTGAAAGGTGGGCTTAATACCCCACTGCATGAG
AGTGACTTCTCTGGTGTGACCCCACAGCGGCAAGTTGTGCAGACTCCAAATACAGTTCTGTCTACCCCTTTCAGGACTCC
TTCTAATGGAGCTGAAGGGCTGACTCCCCGAAGTGGAACAACTCCTAAACCAGTCACTAATGCCACCCCAGGTAGAACAC
CACTTAGAGACAAGTTAAACATTAATCCAGAGGATGGAATGGCAGACTACAGTGACCCCTCTTACGTGAAGCAGATGGAA
AGAGAATCTCGTGAACATCTCCGTTTAGGGTTGTTAGGCCTCCCCGCACCTAAGAATGATTTTGAAATTGNTCTGCCTGA
AAATGCCGANAAGGAACTAGAAGAACGTGAAATAGATGATACCTACATTGAAGATGCTGCTGATGTGGATGCTCGAAAGC
AGGCCATCCGAGATGCTGAGCCGTGTAAAGGAAATGAAACGAATGCATAAAGCTGTTCAGAANGATCTGCCCAGGCCGTC
TGAAGTAAATGAAACTATTTTAAGACCTTTAAATGTANAACCACCTTCTAACAGATTTACCNGAAGAGTGAAGAACTGAT
CAAAAAAAGAAATTCA
Sequence Type mRNA
Unitrap ID UNI7034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45544902..45550221 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023932 (Cdc5l) NM_152810 cell division cycle 5-like (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1918952]

 
Come back to gene ENSMUSG00000023932


For any suggestions or comments, please send an email to unitrap@crg.es