Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST44745
Clone ID OST44745
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST44745
Sequence
CACACCAAGCTGTGGTAATGCAGTTTATTATGGAAATGGCCAAAAACTGCAATGTGGATCCAAGAGGCTGTTTTCGTTTG
TTTTTCCAGAAAGCCAAAGCGGAGGAAGAAGGTTATTTTGAAGCATTCAAAAATGAACTTGAAGCTTTCAAGTCAAGAGT
AAGACTTTACGCTCAATCACAAAGCTTGCAGCCTGTGACAGTTCAGAATCATGTCCCCCATTCTGGTGTTGGATGCATAG
GCTCCTTAGAATCCTTACCACAGGNTNNAAAATTTNACAACCNACTGTNNNCAGGANNNTNTGANNGCTNAATTGGNACN
TTCAACAGGTGTTTTTTCTTA
Sequence Type mRNA
Unitrap ID UNI13407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29082088..29086544 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024780 (Cdc37l1) NM_025950 cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914322]

 
Come back to gene ENSMUSG00000024780


For any suggestions or comments, please send an email to unitrap@crg.es