Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF052
Clone ID XF052
Vector pGT2Lxf
Project baygenomics

Sequence tag XF052
Sequence
CTGACCTTGAATGGGATGCAGGCCATAAAACCAATGTCCAGCAGTGCTACTGCTATTGTGGAGGCCCTGGAGACTGGTAT
TTAAAGATGCTGCAGTGCTGCAAATGTAAGCAGTGGTTTCATGAAGCTTGTGTCCAATGCCTTCAGAAGCCAATGCTGTT
TGGAGATAGGTTTTATACATTTATTTGCTCTGTCTGCAGTTCTGGACCAGAATACCTCAAACGTCTACCGTTACAGTGGG
TAGATATAGCACACCTATGCCTTTACAACCTAAGTGTTATTCACAAGAAGAAATACTTTGATTCTGAACTTGAGCTTATG
ACATACATTAATGAAAACTGGGATAGATTGCACCCTGGAGAGCTGGCAGACACACCCAAATCTGAAAGATATGAGCATGT
TCTGGAGGCATTAAATGATTACAAGACCAT
Sequence Type mRNA
Unitrap ID UNI8991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108517036..108528205 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es