Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST44557
Clone ID OST44557
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST44557
Sequence
GAGAACTGGCCTATGATCTGGATGTGGACGATGCTCCGGGGAACAAGCAGCATGGAAATCACGAAGGACAACGAGATCAC
CACCTCTCACAGCGTGGGGAACATGCCGTCCCCACTGAAGATCCTCATCAGTGTGGCCATCTATGTGGCGTGCTTTTTTT
T
Sequence Type mRNA
Unitrap ID UNI9144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49625975..49626133 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055653 (Gpc3) NM_016697 glypican 3 Gene [Source:MGI (curated);Acc:Gpc3-001]

 
Come back to gene ENSMUSG00000055653


For any suggestions or comments, please send an email to unitrap@crg.es