Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST44098
Clone ID OST44098
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST44098
Sequence
TAGTTCTCCAGATTCTANTGGGGCAGGAGGCATCTCCCCCCAACATATAGCTCAAGATTCCTCACTGGATGGACCTCCAG
GCCCACAAGATGGTACCACAGTTCCTCTGGAGGGGTTCAGCTTATCCCATGCTGCTGACCTGGTCAACAGGGGTCAGAAG
TGGGAGAAGAGCCATGCAGAAATTGCAGAGCAAGCCAAACATGAA
Sequence Type mRNA
Unitrap ID UNI22478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134663145..134663347 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es