Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43733
Clone ID OST43733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43733
Sequence
GACTGAGGTGGTGACTGGACTCTAGACCATGTGCCTAGGTAGTTTTTCCCTTCTCCGCAGCTCTGCTTCCCCAGCAACGC
TCACCACACCCTTGTTTTGAGAACCTCACTAAGTACTTGTCAGCATCCAGCCATGGGGGATATGAAAACTCCAGATTTTG
ATGATCTCCTGGCTGCCTTTGACATCCCAGATCCCACAAGTCTTGATGCAAAGGAGGCCATCCAGGCTCCCAGTGAGGAG
AATGAGAGTCCCCTGAAGTCTTCAGGCATGTGTATCGATGAGAATGTGTCCTTGTCGCACTCAGGATCAGCCCCAGATGT
GCCAGCCGTGAGTGTCATTGTCAAGAACACCAGCCGCCAAGAGTCGTTTGAAGCAGAGAAAGACCACATTGNTTCCANGC
TTCTTACATAATGGATTCCGGGGCTCANACCTGCCCCCAGACTCAGAG
Sequence Type mRNA
Unitrap ID UNI27510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88154318..88168486 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005621 (Zfp592) NM_178707 zinc finger protein 592 Gene [Source:MGI (curated);Acc:Zfp592-001]

 
Come back to gene ENSMUSG00000005621


For any suggestions or comments, please send an email to unitrap@crg.es