Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43713
Clone ID OST43713
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43713
Sequence
TGAGCAGCATCTGGAATCAAGAGAGCCACAGTATCTGAGGGACCTTCCGCCTCTGTCATGCCTGTTAAAAAAATAGGCCA
TCGAAGTGTTGATTCCTCTGGAGAGACTACATACAAGAAGACAACTTCATCAGCCTTGAAAGGTGCCATCCAGTTAGGCA
TCACTCACACTGTGGGCAGCCTGAGCACCAAACCAGAGCGTGATGTCCTCATGCAAGACTTCTACGTGGTGGAGAGCATC
TTTTTCCCCAGGTACAGAGGTCAATGTCTCTGAGAATGTCCTAGACAACTTGACTTTGCTCAGCCTCAGGACACTTTCAA
GGGTTCTCATCATCCCTTAACCTTGTTGNATATTTAAGATAATGGGATTAGAGAAATTCTNNCAGNAAGGCTTTTGCCNA
ATGCTTNNTGGACAGTGGGAGTATCTTATA
Sequence Type mRNA
Unitrap ID UNI18295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94877744..94886749 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028126 (Pip5k1a) NM_008847 phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI (curated);Acc:Pip5k1a-002]

 
Come back to gene ENSMUSG00000028126


For any suggestions or comments, please send an email to unitrap@crg.es