Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43615
Clone ID OST43615
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43615
Sequence
CTGAGGTTCAAAAGAAAACAAGAGGCCCCAGAGGGAAAAGAAGCCCAAAGTTTTAAAGAGCCCAGGCTGCTGAGGACCTC
TCCCANCCGTTCCTGATGGTCATNCTGCCCNCTCCTCCCCAGGGCTGAGATTACAGGCATAGGCCAAGGAACACCTGTGG
NTTATGGGGATNGAATCCAGGCTATCTAGCACATTAGGCATGCAATCGCTCCACCAANTGGGCTACATTCCTAACTGCCT
CTCCTCTCCTCCACACTGCCAACCCCGCTTCACTTGCGGCCCAAGCTGTNCTCAAACTTAAGTGATTCACAGCATAANGC
TAAAGAATATATTNNNCTTTATGTTCCTGTAATTAAACTGACATTGGTTTACAAAGACATTTTAGGGNNATTATGCGTAG
TAATTATCANATCAAGGCATGAAGTCCATGTGG
Sequence Type mRNA
Unitrap ID UNI14203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62309671..62327611 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075009 (Tet1) tet oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:1098693]

 
Come back to gene ENSMUSG00000075009


For any suggestions or comments, please send an email to unitrap@crg.es