Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43602
Clone ID OST43602
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43602
Sequence
ACTGAGTTTCTGATATTCCGAGAGATCTGGAGGTCATTGCCTCCACCCCCACCAGCCTGCTCATCAGTTGGGAACCCCCT
GCCGTCTCTGTGCGCTATTACAGAATCACCTACGGAGAGACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCCGG
AAGCAAGTCCACAGCCACCATCAACAACATTAAACCAGGAGCAGACTACACCATCACCCTGTATGCTGTCACTGGCCGTG
GGGACAGTCCAGCAAGCAGCAAGCCAGTTTCCATCAATTATAAAACAGAAATTGACAAGCCGTCCCAGATGCAGGTGACA
GATGTCCAGGACAACAGCATCAGTGTCAGGTGGCTGCCTTCAACTTCTCCTGTGACAGGCTACAGAGTGACCACCACTCC
CAAAAATGGCCTAGGACCATCAAAAACTAAAACTGNCAGTCCAGATCAAACNGAAATGACCATTGAAGG
Sequence Type mRNA
Unitrap ID UNI27938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71651633..71654596 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es