Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43495
Clone ID OST43495
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43495
Sequence
CTGAGATTTCGACACAGTCCCAACTGCTGGTACCTAAGAGACTGGACCATCCACACCTGGATTAGACAGTGTCTGAAATA
CGGAGCACAAGACAAAGCCTTGTATACACTTGTTAATAAGGTTCAGTATGGAATTTTTNCAGATAACTTTACATTCAACT
TACTGNTGGATTATTTCATAACAAAA
Sequence Type mRNA
Unitrap ID UNI27320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100170215..100170333 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041632 (Mrps27) NM_173757 mitochondrial ribosomal protein S27 Gene [Source:MGI Symbol;Acc:MGI:1919064]

 
Come back to gene ENSMUSG00000041632


For any suggestions or comments, please send an email to unitrap@crg.es