Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43409
Clone ID OST43409
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43409
Sequence
ACTGAGCCAGAAGAAGGAAGAGGAAGATGACGACATGAAGGAATTGGAGAACTGGGCCGGATCCATGTAACTGTTCCAGC
AGAGGCTGGGCCCAGACGGACTCTGGTGGCCTGTGCATCGGGCAGGCATGTGCGTGCGCAGGGCAGGCAGGACGCGGTGC
AGGCAGCCTCCATCGCTCAGCTCTCACCCAAAGCAGTAGCCGCACCACTGCTCACTCTCGCATAGCATGGTCTGTGCCCA
GGGGTGGGTGGGGGGAGGGGGGCGG
Sequence Type mRNA
Unitrap ID UNI9607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154519678..154519939 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038467 (Chmp4b) NM_029362 chromatin modifying protein 4B Gene [Source:MGI (curated);Acc:Chmp4b-001]

 
Come back to gene ENSMUSG00000038467


For any suggestions or comments, please send an email to unitrap@crg.es