Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43381
Clone ID OST43381
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43381
Sequence
AGAACTGAGGATAATTCAGATTCATTGCATCCTTGAAGAGCATCAATAGAAGAGGGAAAAAAAAGATGGGTGTGAAAACA
TTTACTCACAGCTCCTCTTCCCACAGCCAGGAAATGCTGGGGAAACTAAATATGCTCCGAAATGATGGACATTTTTGTGA
TATCACTATTCGTGTCCAGGACAAAATCTTCCGGGCTCACAAGGTAGTACTAGCAGCTTGCAGTGATTTCTTTCGAACCA
AACTTGTTGGCCAAACAGAAGATGAGAACAAAAATGTGTTGGATCTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30860823..30861104 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es