Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43334
Clone ID OST43334
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43334
Sequence
GAACTGAGTAATGGAGGGGAAAGTTCCAGTCGCAGCGCTGAAAAGCGATCACGCTGAAGACGAAGCTGCAGACCTCCCAA
CAAAGCCTACAAAGATGTCCAAGTTTGGATTTGCCATAGGTAGTCAGACGGCACGGAAAGCGTCCGCCATCTCCATTAGA
CTCGGAGCAAGTAAGCCTAAGGAAACAGTTCCAACTCTTGCTCCAAAAACTCTGTCGGTAGCAGCAGCTTTCAATGAAGA
TGAAGATAGTGAGCCAGAAGAAATGCCTCCAGAAGCAAAGATGAGGATGAAGAACATTGGAAGGNGCCGNGCTTTCATAA
TTATCATAGAGCTGTAGGANAAGCGAGGACAAGAATNCAGTACACGTTACCACNANGAATTAACATCTAAATCGATCTAC
AATTTCTTTGGGTCAATTAANTGCAGNCCCAGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56018458..56024501 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071533 (Pcnp) NM_001024622 PEST proteolytic signal containing nuclear protein Gene [Source:MGI (curated);Acc:Pcnp-008]

 
Come back to gene ENSMUSG00000071533


For any suggestions or comments, please send an email to unitrap@crg.es